Summary
Background & aims
Human milk is known to be the best food for infants, as it contains all of the nutrients they need and also helps to protect them against infection. Staphylococcus aureus is one of the most common clinical and foodborne pathogens. It produces a variety of extracellular protein toxins, including enterotoxins, exfoliative toxin (ET), haemolysins and Panton-Valentine leukocidin (PVL). This study was carried out to evaluate the Xpert MRSA/SA nasal (Cepheid) PCR assay for the detection of Methicillin-Resistant S. aureus (MRSA) and Methicillin-susceptible S. aureus (MSSA) isolates, and to analyse the frequency of genes encoding the classical antigenic staphylococcal enterotoxins (SE) and exfoliative toxins (ET) in S. aureus strains isolated from raw human breast milk (HBM).
Methods
A total of 72 milk samples were collected from mothers who had delivered in the hospital between 16 February 2014 and 24 April 2016. Samples were cultured and bacterial colonies were identified phenotypically by standard bacteriological methods. All staphylococci strains isolated by routine tests were examined with MALDI-TOF-MS. Then PCR Xpert MRSA/SA nasal was performed on the closed GeneXpert® random access platform (Cepheid), then the house-PCR to detect SE genes and ET genes.
Results
S. aureus was identified in 86.2% (62/72) of the 72 Staphylococcus spp isolated from raw milk culture. PCR results showed that 30 of the 62 S. aureus strains (48.3%) harboured genes coding for toxins. sea was the most prevalent virulence gene (24.1%), followed by see (12.9%) and eta (12.9%) genes.
Conclusions
Xpert MRSA/SA nasal complete assay allows rapid and accurate identification of MRSA and MSSA. This assay is very easy to perform and is useful for the diagnosis of milk contamination by S. aureus in human milk banks. These results suggest the potential infant health threat related to S. aureus contamination of HBM. Efforts are therefore required to improve safety standards to prevent staphylococcal food poisoning in these infants.
Keywords
1. Introduction
HBM is considered to be the best food for infants, as it contains all of the nutrients they need and also helps to protect them against infection. Healthcare professionals generally agree that properly collected and stored HBM is appropriate for healthy full-term and preterm babies. However, for many reasons, breast-feeding may be impossible or inadvisable.
Milk is a good substrate for Staphylococcus aureus growth and enterotoxin production [
[1]
]. The presence of S. aureus in HBM samples can be explained by secondary contamination from the skin, breasts and nasal cavity of milk donors and healthcare professionals, or alternatively, unsatisfactory conditions of the utensils used [[2]
]. Since its first description, MRSA has become a major public health issue because of worldwide spread of several clones. The specific genetic mechanism of its resistance has been identified as a mobile genetic element (Staphylococcal Cassette Chromosome mec – SCCmec) integrated into the S. aureus chromosome, within which the mecA gene encodes a specific methicillin-resistant transpeptidase (penicillin-binding protein 2a-PBP2a) [[3]
]. A new divergent mecA homologue (mecC or mecA LGA251) was described in a novel SCCmec named type XI [[4]
] in S. aureus or coagulase-negative staphylococci (CoNS).S. aureus produce a variety of extracellular protein toxins, including enterotoxins, toxic shock syndrome toxin 1 (TSST-1), ET, haemolysins, coagulase and Panton-Valentine leukocidin (PVL). S. aureus is one of the most commonly isolated pathogenic bacteria and is responsible for many nosocomial infections, besides being the main causative agent of food poisoning by virtue of its wide range of enterotoxins. According to serological classification, seven classical antigenic SEs have been identified as SEA, SEB, SEC1, SEC2, SEC3, SED, SEE and SEH [
5
, 6
, 7
]. Munson et al. [[8]
] identified and characterized seg and sei, while Zhang et al. [[9]
] identified the gene sej. Several other toxins, called enterotoxins SEK, SEL, SEM, SEN, SEO, SEP, SEQ, SER and SEU, have been described, and their genes have been sequenced [[1]
]. Toxic shock syndrome in humans and animals is caused by the presence of S. aureus isolates producing TSST-1 [[10]
]. The tsst gene is chromosomal. Enterotoxins, as well as TSST-1, belong to a family of superantigens [[11]
]. Some strains of S. aureus producing one or both of two distinct ET, A (ETA) or B (ETB), have been associated with a series of impetiginous staphylococcal diseases referred to as staphylococcal scalded-skin syndrome [[12]
]. PVL produced by less than 5% of S. aureus strains is a pore-forming toxin encoded by the lukS-PV and lukF-PV genes [[13]
].In the light of the above findings, the present study was designed to: (i) evaluate the ability of the Xpert MRSA/SA real-time PCR assay (Cepheid, Sunnyvale, CA) to detect MRSA and MSSA isolates in a collection of staphylococci strains isolated from HBM; (ii) analyse the frequency of genes encoding SEA, SEB, SEC, SED, SEE, ETA and ETB in S. aureus strains isolated from raw HBM.
2. Materials and methods
2.1 Human milk bank and sample collections
We conducted a retrospective study over a 26-month period from 16 February 2014 to 24 April 2016. Seventy-two HBM samples were collected under aseptic conditions and transported frozen to the Amiens University Hospital milk bank (France), in which milk is voluntarily donated by mothers who have delivered in the hospital. To ensure optimum quality of milk donations, the donors were instructed in the appropriate methods for sanitary collection, handling, storage and transportation of the breast milk according to the French Ministry of Health recommendations [
[14]
]. In the milk bank, the milk was processed according to a detailed protocol defined by Ministry of Health recommendations [[14]
].The study was conducted according to the Code of Ethics of the World Medical Association (Declaration of Helsinki) and all procedures were approved by the Picardie Human Research Ethics Committee.
2.2 Bacteriological screening and Staphylococci counts
Seventy-two fresh-frozen HBM samples were transported on dry ice from the milk bank to the hygiene laboratory. One milk tube, corresponding to approximately 2 mL of raw milk, of each sample was taken. Each sample was screened for contamination by normal skin flora as follows: 10 μL of sample were seeded on sheep blood Columbia agar (5%) and Chapman agar (Bio-Rad, France). After incubation at 37 °C for 48 h, colonies presenting morphological characteristics of staphylococci were counted. Sheep blood agar was used for counting of normal skin flora and Chapman agar was used for counting of S. aureus colonies. Milk acceptable for dispensing raw must contain ≤ 106 CFU/mL of skin flora and <104 CFU/mL of S. aureus.
2.3 Identification of S. aureus
Strains positive for mannitol, catalase, Gram staining and bound coagulase (Pastorex Staph Plus-Bio-Rad) were classified as S. aureus and stored at −80 °C in sterile Mueller-Hinton (M. H) medium enriched by horse serum, then seeded in conservation tubes.
2.4 MALDI-TOF-MS
All staphylococci strains isolated by routine tests were examined by Matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF-MS) (Brucker Daltonics, Bremen, Germany) according to the previously described procedure [
[15]
]. Absolute ethanol was used for sample preparation and 1 μL of DHB matrix solution (2,5-dihydroxybenzoic acid, 50 mg/mL, 30% acetonitrile, 0.1% trifluoroacetic acid) was added. Flex control 3.0 software and Biotyper 2.0 database (Brucker Daltonics) were used to calculate and process the analytical data, as previously described [[16]
]. Identification was performed in duplicate and the identification score cut-off was applied to each measurement, according to the manufacturer's instructions.2.5 Methicillin agar screen
Susceptibility to oxacillin was determined by the disk diffusion method on M.H agar at 37 °C for 24 h on disks loaded with 30 μg of cefoxitin and 6 μg of benzyl penicillin, according to the recommendations of the Comité de l'Antibiogramme de la Société Française de Microbiologie (CA-SFM) and European Committee on Antimicrobial Susceptibility Testing (EUCAST) guidelines V1.0 February 2013.
2.6 Xpert MRSA/SA nasal PCR assay
This test was performed on the closed GeneXpert® random access platform (Cepheid), allowing autonomous, fully integrated and automated molecular analysis: the extraction, amplification, and detection of amplified products steps are performed successively in the same cartridge. This method uses automated real-time PCR technology to detect proprietary sequences of genes that encode S. aureus protein A, the methicillin resistance element (mecA) and the Staphylococcal Cassette Chromosome (SCCmec). The Xpert MRSA/SA nasal assay was performed according to the manufacturer's instructions on the GeneXpert® system (Cepheid).
Briefly, bacterial suspension 0.5 McFarland was diluted to 1:100 and then vortexed for 10 s. This dilution (100 μL) was transferred to the elution reagent vial, and then vortexed for 10 s. The entire sample was then dispensed into the S chamber of the cartridge, followed by reagent 1 into port 1, and reagent 2 into port 2, and the cartridge was inserted into the GeneXpert® apparatus and the assay was started. The results were available within 71 min. The following results were considered: spa+ mecA− SCCmec− (MSSA), spa+ mecA+ SCCmec+ (MRSA). Although not recommended by the manufacturer, in the case of MRSA-/SA-, the result was extrapolated to indicate methicillin-resistant coagulase-negative staphylococci (MRCoNS) when mecA was positive or methicillin-susceptible coagulase-negative staphylococci when mecA was negative (MSCoNS). The Cepheid assay used in this study has not been validated for the identification of MRSA and MSSA isolated from HBM.
2.7 DNA isolation and PCR conditions
Total DNA was extracted by using the NucliSENS easy MAG extractor apparatus (BioMérieux, France) according to the manufacturer's instructions. Oligonucleotides ranging from 120 to 200 bp were selected from the published DNA sequences of the S. aureus genes [
[17]
] (Table 1). PCR was performed with a final volume of 50 μL according to the Master Mixes of components from the QIAGEN Top Taq master mix kit. Each reaction contained 25 μL of Master Mix, 1 μL of each primer, 2 μL of DNA as template, 5 μL of CoralLoad and 16 μL of RNase-free water. The amplification conditions were 94 °C for 5 min followed by 35 cycles of amplification (denaturation at 94 °C for 2 min, annealing at 57 °C for 2 min, and an extension at 72 °C for 1 min), and a final extension at 72 °C for 7 min. All PCR amplifications were carried out in a Veriti Thermal Cycler (Applied Bio System, France).Table 1Nucleotide sequences, gene locations, and predicted sizes of amplified products for the staphylococcal toxin-specific oligonucleotide primers used in this study.
| Gene | Primer | Oligonucleotide sequence (5′→3′) | Location within the gene | Size of amplified product (bp) |
|---|---|---|---|---|
| sea | SEA-1 | TTGGAAACGGTTAAAACGAA | 490–509 | 120 |
| SEA-2 | GAACCTTCCCATCAAAAACA | 591–610 | ||
| seb | SEB-1 | TCGCATCAAACTGACAAACG | 634–653 | 478 |
| SEB-2 | GCAGGTACTCTATAAGTGCC | 1091–1110 | ||
| sec | SEC-1 | GACATAAAAGCTAGGAATTT | 676–695 | 257 |
| SEC-2 | AAATCGGATTAACATTATCC | 913–932 | ||
| sed | SED-1 | CTAGTTTGGTAATATCTCCT | 354–373 | 317 |
| SED-2 | TAATGCTATATCTTATAGGG | 632–671 | ||
| see | SEE-1 | TAGATAAAGTTAAAACAAGC | 491–510 | 170 |
| SEE-2 | TAACTTACCGTGGACCCTTC | 640–659 | ||
| eta | ETA-1 | CTAGTGCATTTGTTATTCAA | 374–393 | 119 |
| ETA-2 | TGCATTGACACCATAGTACT | 473–492 | ||
| etb | ETB-1 | ACGGCTATATACATTCAATT | 51–70 | 200 |
| ETB-2 | TCCATCGATAATATACCTAA | 231–250 | ||
a Nucleotide sequence and locations derived from published nucleotide sequences
[1]
.3. Results
Over a 26-month of study period, 72 staphylococci strains isolated from raw milk culture were identified as S. aureus by agglutination test (Pastorex Staph Plus) at concentrations ranging between 103 and 106 CFU/mL. All 72 staphylococci isolates were examined by MALDI-TOF-MS. Pastorex Staph Plus correctly identified 62 of these isolates, which were confirmed to be S. aureus (86.2%) and ten (13.8%) isolates, which were identified as Staphylococcus lugdunensis. Two of the ten S. lugdunensis isolates were spa gene positive and eight were spa gene-negative by GeneXpert® assay. All 62 S. aureus identified were spa gene positive. Overall, Pastorex Staph Plus results were concordant with Xpert results in 88.8% (64/72) of cases versus 11.2% (8/72) of discordant cases. Eight of these discordant results were Pastorex Staph Plus-positive results and Xpert-negative results (Table 2).
Table 2Phenotypic and genotypic characteristics of S. aureus and S. lugdunensis strains isolated from human milk before pasteurization.
| Agglutination test | Identification of strains | Phenotypic characters | Genotypic characters | Total | ||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Pastorex Staph Plus | MALDI-TOF-MS | Oxacillin | Cefoxitin | SPA+ Mec− SCC− | SPA+ Mec+ SCC+ | SPA+ Mec+ SCC− | SPA+ Mec− SCC+ | SPA− Mec− SCC− | SPA− Mec+ SCC+ | |
| + | S. aureus | R | R | – | + | – | – | – | – | 3 |
| + | S. aureus | R | R | – | – | + | – | – | – | 10 |
| + | S. aureus | S | S | – | – | – | + | – | – | 1 |
| + | S. aureus | S | S | + | – | – | – | – | – | 48 |
| 62 | ||||||||||
| + | S. lugdunensis | S | S | – | – | – | – | + | – | 7 |
| + | S. lugdunensis | R | R | – | – | – | – | – | + | 1 |
| + | S. lugdunensis | S | S | + | – | – | – | + | – | 1 |
| + | S. lugdunensis | S | S | – | – | + | – | – | – | 1 |
| 10 | ||||||||||
| TOTAL | 72 | |||||||||
11.2% (8172) of cases were discordant. Eight of these discordant results were Pastorex Staph Plus positive results and Xpert negative results.
Eight (80%) of the 10 S. lugdunensis isolates were phenotypically methicillin-susceptible coagulase-negative staphylococci (MsCoNS) and genotypically spa− mec− SCCmec− and were interpreted by GeneXpert® as MRSA−/SA−; one was phenotypically MSCoNS and genotypically spa+ mec+ SCCmec− and was interpreted by GeneXpert® as MRSA−/SA− and another was phenotypically methicillin-resistant CoNS (MRCoNS) and genotypically spa− mec+ SCCmec+ and was interpreted by GeneXpert® as MRSA−/SA−. Among the 62 S. aureus strains identified, 48 (77.4%) were phenotypically methicillin-susceptible S. aureus (MSSA) and genotypically spa+ mec−SCCmec− and were interpreted by GeneXpert® as MRSA−/SA+ (MSSA); ten (16.2%) were phenotypically methicillin-resistant S. aureus (MRSA) and genotypically spa+ mec+ SCCmec− and were interpreted by GeneXpert® as MSSA, three (4.8%) were phenotypically MRSA and genotypically spa+ mec+ SCCmec+ and were interpreted by GeneXpert® as MRSA+/SA+, and one strain (1.6%) was phenotypically MSSA and genotypically spa+ mec− SCCmec+ and was interpreted by GeneXpert® as MSSA (Table 2). Of 62 S. aureus strains, 44 (70.9%) were positive for se or et genes, among which 35 (79.5%) strains carried SE genes and 9 (20%) carried ET genes. Of the genes that code for SEA-SEE, sea was the most frequent, it was found in 15 (24,1%), isolates, followed by see in 8 (12.9%) (Table 3). Of the genes that code for ETA-ETB, eta were the most frequent (12.9%) (Table 3). Table 4 shows 12 different genotype toxin profiles: 6 genotypes contained a single toxin gene (a, b, c, d, e and eta); 4 genotypes contained each two toxin genes (b + e, c + e, a + eta, and e + etb); 1 genotype contained three toxin genes (a + b + eta) and 1 genotype contained four toxin genes (a + b + d + eta).
Table 3The percentages of S. aureus strains positive for staphylococcal enterotoxins (SE) and exfoliative toxins (ET) genes.
| Gene | Number of strains tested | Number of positive strains | (%) |
|---|---|---|---|
| sea | 62 | 15 | (24.1) |
| see | 62 | 8 | (12.9) |
| eta | 62 | 8 | (12.9) |
| seb | 62 | 6 | (9.6) |
| sec | 62 | 4 | (6.4) |
| sed | 62 | 2 | (3.2) |
| etb | 62 | 1 | (1.6) |
Among the S. aureus strains isolated from breast milk, 24.1% harboured sea genes and 12.9% harboured see and eta genes. These genes appeared to be more prevalent.
Table 4Toxin gene profile of S. aureus isolated from human breast milk.
| Toxin gene profiles | Number of S. aureus strains positive for se and et genes |
|---|---|
| a | 1 |
| b | 3 |
| c | 2 |
| d | 1 |
| e | 11 |
| eta | 1 |
| a + eta | 5 |
| a + b + d + eta | 1 |
| a + b + eta | 1 |
| b + e | 1 |
| c + e | 2 |
| e + etb | 1 |
Sea(a), seb(b), sec(c), sed(d), see(e) (staphylococcal enterotoxin genes), eta, etb (exfoliative genes).
4. Discussion
Although French legislation does not define acceptable limits for the amount of S. aureus in HBM, the quantity of toxins produced by toxigenic S. aureus are known to achieve levels that are sufficient to induce symptoms of food-borne disease for S. aureus concentrations ≥ 105 CFU/mL, as was the case for 7 (11.2%) of the 62 raw HBM samples. Milk and milk products have frequently been implicated in staphylococcal food poisoning and contaminated raw milk is often involved. Human handlers, milking equipment, and the environment are possible sources of bulk milk contamination. Several researchers have reported different results for bacterial counts in contaminated dairy products expressed in CFU/mL [
18
, 19
, 20
]. Variations in S. aureus counts in milk may depend on the sanitary precautions observed during the milk processing chain. In the present study, we used the routine bacteriological procedure for isolation of S. aureus from HBM. In view of the findings and comparing the routine technique with Xpert MRSA/SA results, the Xpert MRSA/SA nasal test for amplification of spa, mecA and SCCmec genes can be considered to allow rapid diagnosis and confirmation of S. aureus isolates. The present study showed that 10 (13.8%) of the 72 staphylococci identified had a positive result on the Pastorex Staph Plus test, two of which were positive for spa gene on GeneXpert® PCR MRSA/SA and were considered to be false-positive results. These 10 staphylococci isolates were identified by MALDI-TOF-MS as S. lugdunensis. Previous publications have also reported false-positive results on latex agglutination tests, mainly for Staphylococcus intermedius, S. lugdunensis, Staphylococcus schleiferi, Staphylococcus hycus, and Staphylococcus haemolyticus [21
, 22
], indicating that latex agglutination tests must be performed with caution. S. lugdunensis produces a bound coagulase (clumping factor) (which is used in the rapid slide agglutination test), a property it shares with S. aureus, but unlike S. aureus, it does not produce a free coagulase, and can therefore give positive results on the latex agglutination test. S. haemolyticus has been reported in other studies to give false-positive results, probably due to the production of type 5 and 8 capsular polysaccharides [21
, 22
]. The presence of both surface antigens can easily lead to misidentification as S. aureus. Among the 72 staphylococcus isolates detected, 62 (86.2%) were spa gene positive and were confirmed as S. aureus, two (2.7%) were spa gene positive and were identified as S. lugdunensis. The remaining eight (11.1%) isolates without spa gene were identified as S. lugdunensis. The two S. lugdunensis isolates harbouring a spa gene were positive on the Pastorex Staph Plus test and were considered to be false-positive results. Ninety percent of protein A is found in the cell wall and the remaining 10% is free in the cytoplasm of bacteria. The Xpert MRSA/SA assay is the molecular MRSA surveillance method most commonly used in our laboratory. The use of GeneXpert® to characterize staphylococci and their resistance to methicillin has been well documented [23
, 24
]. The mechanism mediating methicillin resistance in S. aureus can be easily detected by using either mecA or the SCCmec/orfX junction as a marker [- Hombach M.
- Pfyffer G.E.
- Roos M.
- Lucke K.
Detection of methicillin-resistant Staphylococcus aureus (MRSA) in specimens from various body sites: performance characteristics of the BD GeneOhm MRSA assay, the Xpert MRSA assay, and broth-enriched culture in an area with a low prevalence of MRSA infections.
J Clin Microbiol. 2010; 48: 3882-3887
25
, 26
]. GeneXpert® detects only a single staphylococcal target, corresponding to the junction at which SCCmec, the genetic element that contains the mecA gene and which confers resistance to methicillin, integrates the S. aureus chromosome. The integration site of the cassette into the staphylococcal genome is located in OrfX that is unique to S. aureus with its internal mecA gene that inserts into the OrfX and, in so doing, splits orfX into two parts. This target is called the SCCmec/OrfX junction region. This region is usually highly conserved [27
, 28
]. Molecular characterization studies of this region identified eight SCCmec types (I to VIII) [29
, 30
], as well as a large number of nontypeable and new SCCmec types. The mecA gene encodes PBP2a, which is involved in peptiglycan synthesis and confers resistance to all β-lactam antibiotics due to low-affinity binding, thereby overcoming the inhibition of native PBP conferred by these antibiotics.A good agreement between the phenotypic method and Xpert assay was observed in 62 (86.2%) of the 72 staphylococci species isolated from HBM cultures with pure growth, while a discordance between the phenotypic method and Xpert assay was observed in 13.8% (10/72) of cases (Table 5). These strains were phenotypically methicillin-resistant and cefoxitin-resistant and genotypically spa+ mec+ SCCmecA- and were misinterpreted as MSSA by Xpert. These strains have been considered to be false-negative for MRSA. False-negatives for MRSA have been reported in isolates with atypical or novel SCCmec types as a result of polymorphisms. The SCCmec/orfX PCR target fails to amplify. These spa+ mecA+ SCCmec- are interpreted as MSSA by the Xpert® system [
[4]
] and these strains are called “empty cassette” variants because they have SCCmec lose just the mecA portion of the cassette through excision, while the basic structure of the element, the mecA gene, remains intact and the mecA portion of the cassette is therefore “empty”, at least in terms of its ability to confer methicillin resistance [[31]
]. Various incorrectly identified mechanisms of MRSA isolates have been described [- Chlebowicz M.A.
- Nganou K.
- Kozytska S.
- Arends J.P.
- Engelwann S.
- Grundmann H.
- et al.
Recombination between ccrC genes in a type V (5C2 & 5) Staphylococcal Cassette chromosome mec (SCCmec) of Staphylococcus aureus ST 398 leads to conversion from methicillin resistance to methicillin susceptibility in vitro.
Antimicrob Agents Chemother. 2010; 54: 783-791
[32]
]: missing mecA sequences (mecA excision, empty cassettes), prevalence of a SCCmec-like cassette in a CoN isolate, acquisition of a new variant mecA homologue (mecC or mecA LGA251) [33
, 34
] that was recently described in a novel SCCmec named type XI [[35]
]. This newly identified protein has <63% aa identity with PBP2a encoded by mecA. This new mecA homologue has been detected in bacteria from dairy cattle in England and humans in England, Scotland, Denmark [- Shore A.C.
- Deasy E.C.
- Slickers P.
- Brennan G.
- O'Connell B.
- Monecke S.
- et al.
Detection of Staphylococcal cassette chromosome mec type XI carrying highly divergent mec, mecI, mecR1, blaZ and ccr genes in human clinical isolates of clonal complex 130 methicillin-resistant Staphylococcus aureus.
Antimicrob Agents Chemother. 2011; 55: 3765-3773
[33]
] and France [[4]
]. Finally, Donnio et al. [[36]
] reported loss of mecA due to deletion within a type IV cassette. The in vitro selection for resistance to vancomycin has also been shown, in three different MRSA isolates carrying a type II SCCmec, to coincide with conversion of MRSA to MSSA [[37]
]. Other studies have reported transposition/recombination between ccrC1 allele 8 and ccrC1 allele 10 [[31]
] and site-specific chromosomal excision of SCCmec elements from the genome or partial deletion of mec gene complexes involving IS431 elements [- Chlebowicz M.A.
- Nganou K.
- Kozytska S.
- Arends J.P.
- Engelwann S.
- Grundmann H.
- et al.
Recombination between ccrC genes in a type V (5C2 & 5) Staphylococcal Cassette chromosome mec (SCCmec) of Staphylococcus aureus ST 398 leads to conversion from methicillin resistance to methicillin susceptibility in vitro.
Antimicrob Agents Chemother. 2010; 54: 783-791
[37]
] in the mechanism for MRSA-to-MSSA conversion.Table 5Discordance between phenotypic and genotypic results of 11 S. aureus strains analysed.
| Phenotypic result | Genotypic results | Interpretation | ||
|---|---|---|---|---|
| spa+ CT value | mec+ CT value | SCCmec− CT value | ||
| Methicillin-resistant Cefoxitin-resistant | 23.5 | 38.5 | 0 | MRSA−/SA+ = MSSA |
| 23.6 | 36 | 0 | ||
| 23.7 | 37.7 | 0 | ||
| 24 | 38.7 | 0 | ||
| 24.4 | 39 | 0 | ||
| 24.5 | 39.1 | 0 | ||
| 24.7 | 36.7 | 0 | ||
| 25.1 | 36.7 | 0 | ||
| 25.6 | 36.2 | 0 | ||
| 32.5 | 37.1 | 0 | ||
| spa+ CT | mec− CT | SCCmec+ CT | ||
| Methicillin-susceptible Cefoxitin-susceptible | 24 | 0 | 26.5 | MRSA−/SA+ = MSSA |
Amplification data obtained with Xpert MRSA/SA assay for 10 MRSA phenotypes and 1 MSSA phenotype. The 10 MRSA phenotypes had MRSA−/SA+ genotypes with CT values between 23.5 and 32.5 for spa+, >35 for mec+ and CT value = 0 for SCCmec−. The MSSA phenotype had a MRSA+/SA+ genotype with CT values = 24.0 for spa+, 26.5 for SCCmec+ and 0 for mec+.
CT: score cut-off.
In this study, a collection of 62 S. aureus strains isolated from HBM were investigated for the presence of classical SE genes and ET genes by PCR. S. aureus can produce a wide variety of virulence factors. Of the 62 S. aureus isolates investigated, 44 (70.9%) were found to harbour one or more SE or ET genes. Among which 79.5% strains carried SE genes and 20% carried ET genes. This rate (70.9%) is higher to the result reported by Giannatale et al. [
[38]
], and lower than the rates reported by Xie et al. [[39]
] (90.7%) and similar to the result reported by Wang et al. [[40]
] (68.1%). sea was the most prevalent enterotoxin gene detected in this study (24.1%), similar to the result reported by Mehrotra et al. [[10]
] (19.6%) versus 41% for Rall et al. [[1]
] and 44.4% for Xie et al. [[39]
]. The eta gene rate observed in this study was 12.9%, compared to 2.4% and 0.6% for Hayakawa et al. [[41]
], 0.9% for Xie et al. [[39]
], and 0.8% for Wang et al. [[40]
].These discordant results can be attributed to improvements in the handling and sanitary procedures during milk collection and processing. Although the level of S. aureus in milk was considered to be not sufficient to cause disease, the presence of toxin genes can be considered to be a potential risk for infants. Several conditions, such as delayed processing, inadequate refrigeration, poor personal hygiene and post-process contamination are associated with the growth of S. aureus strains harbouring se and et genes.
In conclusion, conventional laboratory tests for the detection of MRSA and MSSA in human milk banks require long incubation times and do not allow rapid decision-making for selection of the most appropriate milk for infants. Most routine laboratory detection of staphylococci isolates in human milk banks is based on latex agglutination tests. This test may take as long as 48 h. MALDI-TOF-MS identification is necessary due to the false-positive results of agglutination tests, which can take at least 50–72 h for the results to reach the milk bank. The Xpert MRSA/SA assay, performed directly on fresh-frozen milk, is an alternative for routine diagnosis. It allows rapid (50 min) and accurate identification of MRSA and MSSA isolates and is suitable for testing on human milk banks. The results of this study provide important preliminary data about the prevalence of S. aureus strains harbouring genes coding for SE and ET in human milk.
Statement of authorships and author agreement
All authors listed on the title page participated in meetings and follow-up discussions that culminated in preparation of this manuscript. M. Biendo and A. Leke were involved in the conception and design of the study, the collection of data and drafted the manuscript and the authors participated in editing and final revisions. All authors have read and approved the final manuscript.
Submission declaration
Submission of this article implies that the work described has not been published previously and it is not under consideration for publication elsewhere.
Conflict of interest
All authors, recruited from the international clinical nutrition support community, have no conflicts of interest to report. No funding support or compensation was received by the participants.
Acknowledgements
The authors would like to thank the Cepheid team (Jérôme Venturella, Cécile Casado and Ricardo Gonzalez Ugarte) for technical support in carrying out this study. This team has no direct or indirect financial interest in this paper. They would also like to thank Hélène Fournet for typing this manuscript.
References
- PCR detection of staphylococcal enterotoxin genes in Staphylococcus aureus strains isolated from raw and pasteurized milk.Vet Microbiol. 2008; 132: 408-413
- Staphylococci in breast milk from women with and without mastitis.Rev Microbiol. 1995; 26: 117-120
- Cloning and nucleotide sequence determination of the entire mec DNA of pre-methicillin-resistant Staphylococcus aureus W315.Antimicrob Agents Chemother. 1999; 43: 1449-1458
- MRSA harboring mecA variant gene mecC. France.Emerg Infect Dis. 2012; 18: 1465-1467
- Characterization of types staphylococcal enterotoxins.J Milk Food Technol. 1973; 36: 610-612
- Characterization and biological properties of a new staphylococcal exotoxin.J Exp Med. 1994; 180: 1675-1683
- Identification and purification of a new staphylococcal enterotoxin, H.Appl Environ Microbiol. 1995; 61: 1438-1443
- Identification and characterization of staphylococcal enterotoxin types G and I from Staphylococcus aureus.Infect Immun. 1998; 66: 3337-3348
- The enterotoxin D plasmid of Staphylococcus aureus encodes a second enterotoxin determinant (sej).FEMS Microbiol Lett. 1998; 168: 227-233
- Multiplex PCR for detection of genes for Staphylococcus aureus enterotoxins, exfoliative toxins, toxic shock syndrome toxin 1, and methicillin resistance.J Clin Microbiol. 2000; 38: 1032-1035
- Role of superantigen in human diseases.J Infect Dis. 1993; 167: 997-1002
- Genetic analysis of extracellular toxins of Staphylococcus aureus.Annu Rev Microbiol. 1989; 43: 375-402
- Involvement of Panton-Valentine leucocidin-producing Staphylococcus aureus in primary skin infections and pneumonia.Clin Infect Dis. 1995; 29: 1128-1132
- Recommandations d'Hygiène pour la préparation et la conservation des biberons.Juillet 2005: 116 (NosoBase n° 16092)
- Rapid identification of staphylococci isolated in clinical microbiology laboratories by matrix-assisted laser desorption ionization-time of flight mass spectrometry.J Clin Microbiol. 2007; 45: 2156-2161
- Rapid identification of bacteria in positive blood culture broths by matrix-assisted laser desorption ionization-time of flight mass spectrometry.J Clin Microbiol. 2010; 48: 444-447
- Detection of genes for enterotoxins, exfoliative toxins, and toxic shock syndrome toxin 1 in Staphylococcus aureus by polymerase chain reaction.J Clin Microbiol. 1991; 29: 426-430
- Toxigenic status of Staphylococcus aureus isolated from bovine raw milk and minas frescal cheese in Brazil.J Food Prot. 2010; 73: 2225-2231
- Detection of enterotoxigenic Staphylococcus aureus isolates in domestic dairy products.Iran J Microbiol. 2010; 2: 137-142
- Detection of enterotoxigenic Staphylococcus aureus in raw milk and dairy products by multiplex PCR.J Food Sci. 2012; 77: M620-M623
- International multicenter evaluation of latex agglutination tests for identification of Staphylococcus aureus.J Clin Microbiol. 2001; 39: 86-89
- Evaluation of six agglutination tests for Staphylococcus aureus identification depending upon local prevalence of meticillin-resistant S. aureus (MRSA).J Med Microbiol. 2006; 55: 283-290
- Evaluation of the Xpert methicillin-resistant Staphylococcus aureus (MRSA) assay using the GeneXpert Real-Time PCR platform for rapid detection of MRSA from screening specimens.J Clin Microbiol. 2008; 46: 3285-3290
- Detection of methicillin-resistant Staphylococcus aureus (MRSA) in specimens from various body sites: performance characteristics of the BD GeneOhm MRSA assay, the Xpert MRSA assay, and broth-enriched culture in an area with a low prevalence of MRSA infections.J Clin Microbiol. 2010; 48: 3882-3887
- Detection of methicillin-resistant Staphylococcus aureus directly from nasal swab specimen by a real-time PCR assay.J Clin Microbiol. 2004; 42: 5578-5581
- Molecular detection of resistant determinants.J Clin Microbiol. 2011; 49: S20-S24
- Genetic diversity among methicillin-resistant Staphylococcus epidermidis (MRSE).Microb Drug Res. 2005; 11: 83-93
- Comparison of molecular typing methods for characterization of Staphylococcus epidermidis: proposal for clone definition.J Clin Microbiol. 2008; 46: 118-119
- The evolution of Staphylococcus aureus.Infect Genet Evol. 2008; 8: 747-763
- Structure and specific detection of staphylococcal cassette chromosome mec type VII.Biochem Biophys Res Commun. 2008; 377: 752-756
- Recombination between ccrC genes in a type V (5C2 & 5) Staphylococcal Cassette chromosome mec (SCCmec) of Staphylococcus aureus ST 398 leads to conversion from methicillin resistance to methicillin susceptibility in vitro.Antimicrob Agents Chemother. 2010; 54: 783-791
- Characterization of Staphylococcus isolates with a partial or complete absence of Staphylococcal cassette chromosome elements.J Clin Microbiol. 2010; 48: 3525-3531
- Methicillin-resistant Staphylococcus aureus with a novel mecA homologue in human and bovine populations in the UK and Denmark: a descriptive study.Lancet Infect Dis. 2011; 11: 595-603
- Rapid detection, differentiation and typing of methicillin-resistant Staphylococcus aureus harbouring either mecA or the new mecA homologue mecALGA251..Clin Microbiol Infect. 2012; 18: 395-400
- Detection of Staphylococcal cassette chromosome mec type XI carrying highly divergent mec, mecI, mecR1, blaZ and ccr genes in human clinical isolates of clonal complex 130 methicillin-resistant Staphylococcus aureus.Antimicrob Agents Chemother. 2011; 55: 3765-3773
- Partial excision of the chromosomal cassette containing the methicillin resistance determinant results in methicillin-susceptible Staphylococcus aureus.J Clin Microbiol. 2005; 43: 4191-4193
- Spontaneous deletion of the methicillin resistance determinant, mecA, partially compensates for the fitness cost associated with high-level vancomycin resistance in Staphylococcus aureus.Antimicrob Agents Chemother. 2008; 52: 1221-1229
- Characterisation of Staphylococcus aureus strains isolated from food for human consumption.Vet Ital. 2011; 47: 165-173
- Genotypes and toxin gene profiles of Staphylococcus aureus clinical isolates from China.Plos One. 2011; 6: 1-10
- Prevalence of virulence genes and biofilm formation among Staphylococcus aureus clinical isolates associated with lower respiratory infection.Afr J Microbiol Res. 2010; 4: 2566-2569
- Production of exfoliative toxin A by Staphylococcus aureus isolated from mastitic cow's milk and farm bulk milk.J Vet Med Sci. 1998; 60: 1281-1283
Article info
Publication history
Published online: May 27, 2017
Accepted:
May 1,
2017
Received:
December 23,
2016
Identification
Copyright
© 2017 The Authors. Published by Elsevier Ltd on behalf of European Society for Clinical Nutrition and Metabolism.
User license
Creative Commons Attribution – NonCommercial – NoDerivs (CC BY-NC-ND 4.0) | How you can reuse 
Elsevier's open access license policy
Creative Commons Attribution – NonCommercial – NoDerivs (CC BY-NC-ND 4.0)
Permitted
For non-commercial purposes:
- Read, print & download
- Redistribute or republish the final article
- Text & data mine
- Translate the article (private use only, not for distribution)
- Reuse portions or extracts from the article in other works
Not Permitted
- Sell or re-use for commercial purposes
- Distribute translations or adaptations of the article
Elsevier's open access license policy
